Upload
Featured Recent Articles Topics Login Upload

Search Results for 'sequences species'

sequences species published presentations and documents on DocSlides.

Using BLAST to Identify Species from Proteins
Using BLAST to Identify Species from Proteins
by olivia-moreira
Adapted from College Board’s “Investigation 3...
Using BLAST to Identify Species from Proteins
Using BLAST to Identify Species from Proteins
by celsa-spraggs
Adapted from College Board’s “Investigation 3...
Analysis of DNA uptake sequences in pathogenic species of the
Analysis of DNA uptake sequences in pathogenic species of the
by edolie
Haemophilus. . genus. Presentation by: Mazin . El...
15.1 – Genetic Comparisons Using DNA
15.1 – Genetic Comparisons Using DNA
by lindy-dunigan
Learning objectives. Students should understand t...
15.1 – Genetic Comparisons Using DNA
15.1 – Genetic Comparisons Using DNA
by lois-ondreau
Learning objectives. Students should understand t...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by olivia-moreira
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
acterisation of mycelia of
acterisation of mycelia of
by murphy
ectomycorrhizal fungi in pure culture Mirco Iotti...
UPTEC X 19045Examensarbete 30 hpDecember 2019Bioinformatic approaches
UPTEC X 19045Examensarbete 30 hpDecember 2019Bioinformatic approaches
by danya
Lauri Mesilaakso AbstractBioinformatic approaches ...
Figure 2 Figure 2. Identification of diverse Simian immunodeficiency virus (SIV) lineages
Figure 2 Figure 2. Identification of diverse Simian immunodeficiency virus (SIV) lineages
by barbara
Peeters M, Courgnaud V, Abela B, Auzel P, Pourrut ...
Phylogenomics Symposium
Phylogenomics Symposium
by conchita-marotz
and Software School. Tandy Warnow. Departments of...
Bombus terrestris , the buff-tailed bumble bee
Bombus terrestris , the buff-tailed bumble bee
by edolie
Native to Europe. A managed pollinator. Commercial...
Figure 2 Figure 2. Molecular phylogeny of 4 Armillifer amillatus specimens based on partia
Figure 2 Figure 2. Molecular phylogeny of 4 Armillifer amillatus specimens based on partia
by dandy
Tappe D, Meyer M, Oesterlein A, Jaye A, Frosch M, ...
How To Blast David A. Kloske
How To Blast David A. Kloske
by liane-varnes
Thermo Fisher / Open Biosystems. Dr. Krishnan K. ...
Amino Acid Sequence Analysis of Cytochrome C in Bacteria an
Amino Acid Sequence Analysis of Cytochrome C in Bacteria an
by jane-oiler
We live in a human-centric world.. Life exists ou...
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT
by luanne-stotts
TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...
Metabolism:
Metabolism:
by alida-meadow
. Cytochrome C in Humans Compared to Other Speci...
Clustering, Phylogenetic
Clustering, Phylogenetic
by margaret
Trees, and Inferences about Evolution. BMMB597E. P...
x0000x0000 2Combine evolutionary information wit
x0000x0000 2Combine evolutionary information wit
by hailey
�� ��...
Phylogenetics of animal pathogens: basic principles and applications
Phylogenetics of animal pathogens: basic principles and applications
by SweetMelody
Dr. EP de Villiers. Adapted from: http://. viralz...
Lecture 8 Mechanisms of Evolution: Genetic Variation - Horizontal Gene Transfer
Lecture 8 Mechanisms of Evolution: Genetic Variation - Horizontal Gene Transfer
by adhesivedisney
October 1, 2019. Jeremy . Glasner. PhD. Science, ...
Chalk Talk
Chalk Talk
by yoshiko-marsland
Tandy Warnow. Departments of Computer Science and...
Chapter 26 – Phylogeny & the Tree of Life
Chapter 26 – Phylogeny & the Tree of Life
by briana-ranney
26.1. Phylogeny. Evolutionary history of a specie...
Daravuth
Daravuth
by phoebe-click
Cheam. Dee Denver, P. h. D. The Denver lab. Depa...
DNA BARCODING CHILLIES
DNA BARCODING CHILLIES
by sherrill-nordquist
BIO-NERDS. :. Say . Wah. Yugraj. Singh. Tanja . ...
Microbial Taxonomy and the Evolution of Diversity
Microbial Taxonomy and the Evolution of Diversity
by marina-yarberry
1. 19. Copyright © McGraw-Hill Global Education ...
Conservation Genomics:
Conservation Genomics:
by natalia-silvester
An Introduction. By Jack Francis. May 2. nd. 201...
S1A - Primary Filters: BEI Reads
S1A - Primary Filters: BEI Reads
by startlecisco
S1 Figure –Venn Diagrams of the Number of Reads ...
TRYPANOSOMIASIS Endotoxin levels in plasmas and CSF patients infected with
TRYPANOSOMIASIS Endotoxin levels in plasmas and CSF patients infected with
by stella
Trypanosoma. . brucei. . rhodesiense. Molecular ...
Kondo et al
Kondo et al
by reese
1 Virus Research(special issue:Integrated Viral Se...
Adkins RM Walton AH Honeycutt RL 2003 Higherlevel systematics of rod
Adkins RM Walton AH Honeycutt RL 2003 Higherlevel systematics of rod
by harper
in our topotypes in Zykov 2004 length of ear 19 a...
0 21 Genomes and Their Evolution
0 21 Genomes and Their Evolution
by deena
Clicker Questions . by . Tara . Stoulig. Which of ...
microRNA computational
microRNA computational
by gelbero
prediction and analysis. Resources. Lecture notes ...
Gene annotation: Combined pipelines
Gene annotation: Combined pipelines
by jacey
Genomics Lesson . 7_3. Hardison. 3/1/15. 1. 3. ap...
Introduction to Phylogenomics
Introduction to Phylogenomics
by SweetiePie
and . Metagenomics. Tandy Warnow. The Department o...
Comparative mapping
Comparative mapping
by paige
Med icago trunca t u l a h a nd boo k v e r s i...
Ph ylogenetic analysis Phylogenetics
Ph ylogenetic analysis Phylogenetics
by felicity
Phylogenetics. is the study of the evolutionary h...
A phylogenetic Glance at
A phylogenetic Glance at
by vivian
d. sr. D. Sarah Werner. Today’s Presentation. In...
Figure 3 Figure 3. . A simple mechanism for recombination in norovirus. 1) RNA transcription by the
Figure 3 Figure 3. . A simple mechanism for recombination in norovirus. 1) RNA transcription by the
by emery
Bull R, Hansman GS, Clancy LE, Tanaka MM, Rawlinso...
Classification of Organisms
Classification of Organisms
by trish-goza
Section 1 - Biodiversity. Biologists have named a...
Analysis of Three Plant Primers:
Analysis of Three Plant Primers:
by lois-ondreau
rbcL. , plant ITS, and . matK. , . to Determine t...